ID: 959922158_959922162

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 959922158 959922162
Species Human (GRCh38) Human (GRCh38)
Location 3:111880278-111880300 3:111880292-111880314
Sequence CCCCCTGATCTAAAGGCAGAATT GGCAGAATTAGAGATATGTTTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 17, 3: 44, 4: 166} {0: 1, 1: 0, 2: 4, 3: 37, 4: 202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!