ID: 959922158_959922163

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 959922158 959922163
Species Human (GRCh38) Human (GRCh38)
Location 3:111880278-111880300 3:111880293-111880315
Sequence CCCCCTGATCTAAAGGCAGAATT GCAGAATTAGAGATATGTTTGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 17, 3: 44, 4: 166} {0: 1, 1: 1, 2: 6, 3: 38, 4: 252}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!