ID: 959956532_959956538

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 959956532 959956538
Species Human (GRCh38) Human (GRCh38)
Location 3:112244748-112244770 3:112244793-112244815
Sequence CCCTAGCTAGTCTTCTGTTCTGT AGAGCATGAAACCACACTAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 194} {0: 1, 1: 0, 2: 1, 3: 5, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!