ID: 959963884_959963887

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 959963884 959963887
Species Human (GRCh38) Human (GRCh38)
Location 3:112332565-112332587 3:112332586-112332608
Sequence CCTGGACCACAGAGCGAGACTCC CCGTCTCAAGAAGAAGAAGAAGG
Strand - +
Off-target summary {0: 18, 1: 1484, 2: 33479, 3: 88856, 4: 142137} {0: 1, 1: 2, 2: 10, 3: 109, 4: 1040}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!