|
Left Crispr |
Right Crispr |
| Crispr ID |
959963884 |
959963888 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:112332565-112332587
|
3:112332595-112332617
|
| Sequence |
CCTGGACCACAGAGCGAGACTCC |
GAAGAAGAAGAAGGAGAAGAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 18, 1: 1484, 2: 33479, 3: 88856, 4: 142137} |
{0: 31, 1: 510, 2: 1581, 3: 4255, 4: 10596} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|