ID: 960009283_960009288

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 960009283 960009288
Species Human (GRCh38) Human (GRCh38)
Location 3:112815873-112815895 3:112815911-112815933
Sequence CCCAAGTTCACTGCTGGACCATC GTTGCAGTCCAGAGACAAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 109} {0: 1, 1: 0, 2: 0, 3: 13, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!