ID: 960022730_960022735

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 960022730 960022735
Species Human (GRCh38) Human (GRCh38)
Location 3:112973837-112973859 3:112973863-112973885
Sequence CCAACTCCTACCAACCTTCTACA AAACCAGGACACCCCCACAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 178} {0: 1, 1: 0, 2: 0, 3: 12, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!