ID: 960025015_960025020

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 960025015 960025020
Species Human (GRCh38) Human (GRCh38)
Location 3:112998835-112998857 3:112998864-112998886
Sequence CCAGGAAATTTAATTTTACAGAA CAGGAATATCTGGTGGATTAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 9, 3: 61, 4: 568} {0: 1, 1: 0, 2: 1, 3: 5, 4: 123}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!