ID: 960050398_960050411

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 960050398 960050411
Species Human (GRCh38) Human (GRCh38)
Location 3:113233811-113233833 3:113233857-113233879
Sequence CCACCCACCCCATGCTTGGAAGG CACTAATTAAGAACCACGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 274} {0: 1, 1: 0, 2: 0, 3: 5, 4: 72}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!