ID: 960052594_960052596

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 960052594 960052596
Species Human (GRCh38) Human (GRCh38)
Location 3:113252505-113252527 3:113252527-113252549
Sequence CCTGGGAGGAGAGTAGGGAGGGA ATGGAGAAGCAGTAACAGAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 70, 4: 695} {0: 1, 1: 0, 2: 2, 3: 51, 4: 434}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!