ID: 960065029_960065035

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 960065029 960065035
Species Human (GRCh38) Human (GRCh38)
Location 3:113362347-113362369 3:113362385-113362407
Sequence CCCTTTCTGCTGGTAGTAGCAGG CTGCAGCAGCTTGATGTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 15, 4: 188} {0: 1, 1: 1, 2: 1, 3: 21, 4: 340}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!