ID: 960084625_960084633

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 960084625 960084633
Species Human (GRCh38) Human (GRCh38)
Location 3:113577238-113577260 3:113577280-113577302
Sequence CCCACTATGCACCAAGAACATTG GGAGGCACAAAGGTTAAGAACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 312} {0: 1, 1: 0, 2: 0, 3: 10, 4: 269}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!