|
Left Crispr |
Right Crispr |
| Crispr ID |
960119850 |
960119857 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:113936808-113936830
|
3:113936849-113936871
|
| Sequence |
CCTGCCTCAGCCTCCTGAGTAGC |
CCACCACACCTGGCTAAAATTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 77881, 1: 176222, 2: 210480, 3: 146546, 4: 90715} |
{0: 1, 1: 5, 2: 198, 3: 629, 4: 1635} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|