|
Left Crispr |
Right Crispr |
| Crispr ID |
960119852 |
960119857 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:113936818-113936840
|
3:113936849-113936871
|
| Sequence |
CCTCCTGAGTAGCTGAGATTACA |
CCACCACACCTGGCTAAAATTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3650, 1: 63393, 2: 151745, 3: 233670, 4: 198282} |
{0: 1, 1: 5, 2: 198, 3: 629, 4: 1635} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|