ID: 960143285_960143292

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 960143285 960143292
Species Human (GRCh38) Human (GRCh38)
Location 3:114171928-114171950 3:114171956-114171978
Sequence CCTGTGGAGTTCTCTGCCCCACA AGTTCAGGTGGCCACTCAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 15, 4: 191} {0: 1, 1: 0, 2: 2, 3: 9, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!