ID: 960148977_960148985

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 960148977 960148985
Species Human (GRCh38) Human (GRCh38)
Location 3:114232136-114232158 3:114232179-114232201
Sequence CCAGGCAGCAGGTGGCTCCAGAT AACTGTTGGTAGCAGTAGGGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 34, 4: 286} {0: 1, 1: 1, 2: 1, 3: 21, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!