ID: 960150398_960150401

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 960150398 960150401
Species Human (GRCh38) Human (GRCh38)
Location 3:114243377-114243399 3:114243414-114243436
Sequence CCACTAAAAAGGTTCAGAAATAG TATTCTTTCTTGATATAGAAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 36, 4: 396}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!