ID: 960162803_960162815

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 960162803 960162815
Species Human (GRCh38) Human (GRCh38)
Location 3:114368675-114368697 3:114368714-114368736
Sequence CCAGTAGAGTCCAAGGCCTCCAG CTGGAGCAGGGCTGGAAGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 118} {0: 1, 1: 0, 2: 12, 3: 78, 4: 695}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!