ID: 960183771_960183777

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 960183771 960183777
Species Human (GRCh38) Human (GRCh38)
Location 3:114613986-114614008 3:114614033-114614055
Sequence CCCACCTCCTTCTCCTCATCCTT CATGAGAATTAGTTTTCTTAAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 29, 3: 358, 4: 2748} {0: 1, 1: 0, 2: 1, 3: 26, 4: 246}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!