ID: 960204885_960204892

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 960204885 960204892
Species Human (GRCh38) Human (GRCh38)
Location 3:114884880-114884902 3:114884912-114884934
Sequence CCCTGTAGCTCCTCTAACAAACC GAGCAGACAATGAAATTGCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 147} {0: 1, 1: 0, 2: 0, 3: 12, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!