ID: 960208236_960208239

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 960208236 960208239
Species Human (GRCh38) Human (GRCh38)
Location 3:114929228-114929250 3:114929264-114929286
Sequence CCAGGGAAGAAAAGACTACTACA CTGAAAAAACAGAAGCAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 217} {0: 1, 1: 1, 2: 7, 3: 95, 4: 827}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!