ID: 960246508_960246514

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 960246508 960246514
Species Human (GRCh38) Human (GRCh38)
Location 3:115405677-115405699 3:115405724-115405746
Sequence CCTCCCTCAGGCAAATGGAGAAG CTGCAGAGATGAAAACCAGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 7, 3: 31, 4: 358}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!