ID: 960260103_960260108 |
View in Genome Browser |
Spacer: 10 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 960260103 | 960260108 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 3:115557625-115557647 | 3:115557658-115557680 |
| Sequence | CCCTTTTCTGGTTCAGAGTCAGC | CTGTGACCTCACATAGTGGAAGG |
| Strand | - | + |
| Off-target summary | No data | {0: 3, 1: 34, 2: 446, 3: 1033, 4: 1929} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||