ID: 960284370_960284383

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 960284370 960284383
Species Human (GRCh38) Human (GRCh38)
Location 3:115810718-115810740 3:115810767-115810789
Sequence CCAGCCTCCTCCTGTTGGCCCTG CTCGTTAAGGTTCCAAGCATTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 80, 4: 566} {0: 1, 1: 0, 2: 0, 3: 2, 4: 34}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!