ID: 960321706_960321711

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 960321706 960321711
Species Human (GRCh38) Human (GRCh38)
Location 3:116244692-116244714 3:116244708-116244730
Sequence CCCCTCCTTATTAGAAAACAAAC AACAAACTCCAAAAACATCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 305} {0: 1, 1: 0, 2: 1, 3: 45, 4: 492}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!