ID: 960333876_960333882

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 960333876 960333882
Species Human (GRCh38) Human (GRCh38)
Location 3:116392800-116392822 3:116392840-116392862
Sequence CCAGACTTGAGCAGAGGATAGAG CGGGATGACAAGCTACAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 163} {0: 1, 1: 1, 2: 18, 3: 136, 4: 353}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!