ID: 960373862_960373873

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 960373862 960373873
Species Human (GRCh38) Human (GRCh38)
Location 3:116874589-116874611 3:116874625-116874647
Sequence CCCACATACTTCCTGAGCCCCTT CTGGAAGTTTGGCTAATGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 223} {0: 1, 1: 0, 2: 1, 3: 11, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!