|
Left Crispr |
Right Crispr |
Crispr ID |
960500359 |
960500362 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
3:118430462-118430484
|
3:118430509-118430531
|
Sequence |
CCTTATACATTCTGGATATCAGA |
AATATTTTCTCCCATTCTGTGGG |
Strand |
- |
+ |
Off-target summary |
No data |
{0: 2307, 1: 13777, 2: 17745, 3: 9853, 4: 5024} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|