ID: 960528038_960528043

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 960528038 960528043
Species Human (GRCh38) Human (GRCh38)
Location 3:118732796-118732818 3:118732826-118732848
Sequence CCATATGCCATCATGTGGACCAC GGTCTGAGAGGAAAACAAAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 2, 3: 37, 4: 420}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!