ID: 960533534_960533535

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 960533534 960533535
Species Human (GRCh38) Human (GRCh38)
Location 3:118792319-118792341 3:118792341-118792363
Sequence CCTCATCTTTGAAAATACAGGGT TTTGCTTTGTAATGAATCTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 305} {0: 1, 1: 0, 2: 0, 3: 41, 4: 374}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!