ID: 960535648_960535657

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 960535648 960535657
Species Human (GRCh38) Human (GRCh38)
Location 3:118812107-118812129 3:118812137-118812159
Sequence CCATTCATCTCATCCTGACCACA CTTTGCAAAGGGTAGGTGGATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 20, 4: 299}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!