ID: 960550597_960550603

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 960550597 960550603
Species Human (GRCh38) Human (GRCh38)
Location 3:118972073-118972095 3:118972104-118972126
Sequence CCCAAGTTCCTAAGAACAGAAAG CAAGTGTATCCTTTCTTTAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 266} {0: 1, 1: 0, 2: 1, 3: 8, 4: 139}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!