ID: 960576309_960576315

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 960576309 960576315
Species Human (GRCh38) Human (GRCh38)
Location 3:119233246-119233268 3:119233277-119233299
Sequence CCTCCCTCATTCTACAGAGTGGG TAAAAACCTACCCAAGGCACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 266} {0: 1, 1: 0, 2: 1, 3: 11, 4: 130}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!