ID: 960593831_960593845

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 960593831 960593845
Species Human (GRCh38) Human (GRCh38)
Location 3:119390666-119390688 3:119390711-119390733
Sequence CCAGGGTGGCACTCAGCCCCCAT CTGTGGATGGGGAATCTGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 263} {0: 1, 1: 0, 2: 0, 3: 28, 4: 321}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!