|
Left Crispr |
Right Crispr |
| Crispr ID |
960603740 |
960603741 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:119483795-119483817
|
3:119483808-119483830
|
| Sequence |
CCTAGTAGTAACAATCAAAAATG |
ATCAAAAATGTCTACAGACATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 3, 2: 105, 3: 468, 4: 1205} |
{0: 1, 1: 9, 2: 45, 3: 105, 4: 376} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|