|
Left Crispr |
Right Crispr |
| Crispr ID |
960614391 |
960614397 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:119583632-119583654
|
3:119583666-119583688
|
| Sequence |
CCAAGTGCTGTGGCTTACACCTG |
CTGTGAAAGGCCAAGGTGAGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 62, 2: 1524, 3: 14929, 4: 54909} |
{0: 2, 1: 5, 2: 283, 3: 4156, 4: 34696} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|