ID: 960616266_960616275

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 960616266 960616275
Species Human (GRCh38) Human (GRCh38)
Location 3:119598851-119598873 3:119598885-119598907
Sequence CCCCTCCCTGCTACAAAGTTCCA CATGCTCTCCTTGCACTCATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 178, 4: 2174} {0: 1, 1: 0, 2: 0, 3: 15, 4: 231}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!