ID: 960636484_960636489

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 960636484 960636489
Species Human (GRCh38) Human (GRCh38)
Location 3:119789729-119789751 3:119789753-119789775
Sequence CCCTGTCCTGCCTTCTCTCTGAG GCACTGTGGCTGCCATGCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 61, 4: 545} {0: 1, 1: 1, 2: 2, 3: 32, 4: 238}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!