ID: 960636484_960636493

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 960636484 960636493
Species Human (GRCh38) Human (GRCh38)
Location 3:119789729-119789751 3:119789765-119789787
Sequence CCCTGTCCTGCCTTCTCTCTGAG CCATGCACAGGGCAGGACTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 61, 4: 545} {0: 1, 1: 0, 2: 5, 3: 39, 4: 403}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!