ID: 960672444_960672449

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 960672444 960672449
Species Human (GRCh38) Human (GRCh38)
Location 3:120166429-120166451 3:120166445-120166467
Sequence CCATCAAGAAATAGTGGTGTAGG GTGTAGGGGTGGCTCTGAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 112} {0: 1, 1: 0, 2: 0, 3: 20, 4: 259}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!