ID: 960681647_960681651

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 960681647 960681651
Species Human (GRCh38) Human (GRCh38)
Location 3:120254154-120254176 3:120254180-120254202
Sequence CCTACCACCATCTGACTGTTGAC CTTGACAAAAACAAGCAATAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 79, 4: 819} {0: 12, 1: 413, 2: 5063, 3: 13122, 4: 5577}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!