ID: 960684759_960684772

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 960684759 960684772
Species Human (GRCh38) Human (GRCh38)
Location 3:120285280-120285302 3:120285315-120285337
Sequence CCCGCCCCTCCCTGGCGCCGCCC TCGACCCTGCTCTCCCGCGAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 18, 3: 150, 4: 1218} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!