ID: 960713930_960713936

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 960713930 960713936
Species Human (GRCh38) Human (GRCh38)
Location 3:120557751-120557773 3:120557776-120557798
Sequence CCAGATAGATTTGGAGACAGGGA ATGAAATGCAGAAATTAGGGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!