ID: 960763298_960763301

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 960763298 960763301
Species Human (GRCh38) Human (GRCh38)
Location 3:121097093-121097115 3:121097121-121097143
Sequence CCCAGTTCAAACTTCCTGGCTGC TTACTCTGTGAGCTTAAAACTGG
Strand - +
Off-target summary {0: 5, 1: 138, 2: 953, 3: 2182, 4: 2296} {0: 1, 1: 0, 2: 0, 3: 13, 4: 181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!