|
Left Crispr |
Right Crispr |
| Crispr ID |
960784638 |
960784647 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:121358558-121358580
|
3:121358596-121358618
|
| Sequence |
CCAAACCATTAGAAACCACCACC |
CCCACCAGGCCCCACCTCCTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 7, 2: 35, 3: 219, 4: 630} |
{0: 2, 1: 3, 2: 9, 3: 75, 4: 819} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|