ID: 960784639_960784647

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 960784639 960784647
Species Human (GRCh38) Human (GRCh38)
Location 3:121358563-121358585 3:121358596-121358618
Sequence CCATTAGAAACCACCACCATGAT CCCACCAGGCCCCACCTCCTGGG
Strand - +
Off-target summary {0: 5, 1: 129, 2: 269, 3: 624, 4: 964} {0: 2, 1: 3, 2: 9, 3: 75, 4: 819}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!