ID: 960784642_960784647

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 960784642 960784647
Species Human (GRCh38) Human (GRCh38)
Location 3:121358579-121358601 3:121358596-121358618
Sequence CCATGATTCAGTCACCTCCCACC CCCACCAGGCCCCACCTCCTGGG
Strand - +
Off-target summary {0: 116, 1: 1598, 2: 6824, 3: 10842, 4: 10999} {0: 2, 1: 3, 2: 9, 3: 75, 4: 819}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!