ID: 960788500_960788510

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 960788500 960788510
Species Human (GRCh38) Human (GRCh38)
Location 3:121400214-121400236 3:121400242-121400264
Sequence CCTCCCACCTACCTCTCACCCAG GACTTAGTTTGTTGGGAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 75, 4: 749} {0: 1, 1: 0, 2: 0, 3: 9, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!