ID: 960794652_960794661

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 960794652 960794661
Species Human (GRCh38) Human (GRCh38)
Location 3:121472815-121472837 3:121472867-121472889
Sequence CCCTGAAACATCTGTAAAAATGT ACTAATGTGTACAGTTTCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 71, 4: 861} {0: 1, 1: 0, 2: 1, 3: 17, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!