|
Left Crispr |
Right Crispr |
| Crispr ID |
960798522 |
960798530 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:121514049-121514071
|
3:121514083-121514105
|
| Sequence |
CCAGGCATGGTGGCTCATGCCTG |
CTGTGGGAGGCCAAGGTGGACGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 8252, 1: 39501, 2: 100261, 3: 172981, 4: 199558} |
{0: 14, 1: 1357, 2: 26592, 3: 81400, 4: 160198} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|